Review



resource source identifier anti-ace2 antibody r&d systems cat#af933  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    R&D Systems resource source identifier anti-ace2 antibody r&d systems cat#af933
    Resource Source Identifier Anti Ace2 Antibody R&D Systems Cat#Af933, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 415 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+ace2+antibody+r+d+system+cat/pm35963244-226-2-8?v=R%26D+Systems
    Average 96 stars, based on 415 article reviews
    resource source identifier anti-ace2 antibody r&d systems cat#af933 - by Bioz Stars, 2026-07
    96/100 stars

    Images



    Similar Products

    resource source identifier anti-ace2 antibody r&d systems cat#af933  (R&D Systems)
    96
    R&D Systems resource source identifier anti-ace2 antibody r&d systems cat#af933
    Resource Source Identifier Anti Ace2 Antibody R&D Systems Cat#Af933, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+ace2+antibody+r+d+system+cat/pm35963244-226-2-8?v=R%26D+Systems
    Average 96 stars, based on 1 article reviews
    resource source identifier anti-ace2 antibody r&d systems cat#af933 - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti ace2 antibody r d systems cat  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc resource source identifier antibodies anti ace2 antibody r d systems cat
    Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of <t>ACE2</t> and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
    Resource Source Identifier Antibodies Anti Ace2 Antibody R D Systems Cat, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+ace2+antibody+r+d+system+cat/pm35963244-226-2-38?v=Cell+Signaling+Technology+Inc
    Average 95 stars, based on 1 article reviews
    resource source identifier antibodies anti ace2 antibody r d systems cat - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti ace2 antibody r d systems cat  (Proteintech)
    94
    Proteintech resource source identifier antibodies anti ace2 antibody r d systems cat
    Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of <t>ACE2</t> and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
    Resource Source Identifier Antibodies Anti Ace2 Antibody R D Systems Cat, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+ace2+antibody+r+d+system+cat/pm35963244-226-2-32?v=Proteintech
    Average 94 stars, based on 1 article reviews
    resource source identifier antibodies anti ace2 antibody r d systems cat - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti ace2 antibody r d system cat  (R&D Systems)
    99
    R&D Systems resource source identifier antibodies anti ace2 antibody r d system cat
    Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of <t>ACE2</t> and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
    Resource Source Identifier Antibodies Anti Ace2 Antibody R D System Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+ace2+antibody+r+d+system+cat/pmc07904445__mmc2-181-2-8?v=R%26D+Systems
    Average 99 stars, based on 1 article reviews
    resource source identifier antibodies anti ace2 antibody r d system cat - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

    Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Infection, Neutralization, Transduction

    Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Transfection

    Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Transduction, Expressing, Western Blot, Virus

    Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

    Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Infection, Neutralization, Transduction

    Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Transfection

    Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

    Journal: Cell reports

    Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

    doi: 10.1016/j.celrep.2022.111220

    Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

    Techniques: Transduction, Expressing, Western Blot, Virus